86
|
Thermo Fisher
forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag Forward Primer Reverse Primer Probe Kcnq1 Rs12296050 Gtgcttagactgtgcccg Gggagaccctgtctcgaa Ctcctgggctcctaacctttcacag, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag/product/Thermo Fisher Average 86 stars, based on 1 article reviews
forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag - by Bioz Stars,
2026-04
86/100 stars
|
Buy from Supplier |
90
|
Qiagen
forward and reverse primers Forward And Reverse Primers, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward and reverse primers/product/Qiagen Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Biomics Biotechnologies
forward and reverse primers Forward And Reverse Primers, supplied by Biomics Biotechnologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward and reverse primers/product/Biomics Biotechnologies Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Midland Certified Reagent
forward and reverse primers Forward And Reverse Primers, supplied by Midland Certified Reagent, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward and reverse primers/product/Midland Certified Reagent Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
GeneWorks
forward and reverse primers Forward And Reverse Primers, supplied by GeneWorks, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward and reverse primers/product/GeneWorks Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Eurofins Genomics
primer: thrap3_i2 reverse: caagcagaagacggcatacgagatacatcg attggcctggttcggtcttctc Primer: Thrap3 I2 Reverse: Caagcagaagacggcatacgagatacatcg Attggcctggttcggtcttctc, supplied by Eurofins Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer: thrap3_i2 reverse: caagcagaagacggcatacgagatacatcg attggcctggttcggtcttctc/product/Eurofins Genomics Average 90 stars, based on 1 article reviews
primer: thrap3_i2 reverse: caagcagaagacggcatacgagatacatcg attggcctggttcggtcttctc - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Pacific Biosciences
the primer pair encodes forward and reverse barcodes for amplicon sequencing The Primer Pair Encodes Forward And Reverse Barcodes For Amplicon Sequencing, supplied by Pacific Biosciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/the primer pair encodes forward and reverse barcodes for amplicon sequencing/product/Pacific Biosciences Average 90 stars, based on 1 article reviews
the primer pair encodes forward and reverse barcodes for amplicon sequencing - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Metabion International AG
mouse primers Mouse Primers, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mouse primers/product/Metabion International AG Average 90 stars, based on 1 article reviews
mouse primers - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Biolegio bv
barcoded forward primer and reverse primer mix biolegio bv Barcoded Forward Primer And Reverse Primer Mix Biolegio Bv, supplied by Biolegio bv, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/barcoded forward primer and reverse primer mix biolegio bv/product/Biolegio bv Average 90 stars, based on 1 article reviews
barcoded forward primer and reverse primer mix biolegio bv - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Metabion International AG
forward reverse primers human vegf, vegfr1, vegfr2 β-actin Forward Reverse Primers Human Vegf, Vegfr1, Vegfr2 β Actin, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward reverse primers human vegf, vegfr1, vegfr2 β-actin/product/Metabion International AG Average 90 stars, based on 1 article reviews
forward reverse primers human vegf, vegfr1, vegfr2 β-actin - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Microsynth ag
labelled forward primers Labelled Forward Primers, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/labelled forward primers/product/Microsynth ag Average 90 stars, based on 1 article reviews
labelled forward primers - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Qiagen
mirna-specific assays microrna-specific locked nucleic acid (lna)-enhanced forward reverse primers  Mirna Specific Assays Microrna Specific Locked Nucleic Acid (Lna) Enhanced Forward Reverse Primers, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mirna-specific assays microrna-specific locked nucleic acid (lna)-enhanced forward reverse primers/product/Qiagen Average 90 stars, based on 1 article reviews
mirna-specific assays microrna-specific locked nucleic acid (lna)-enhanced forward reverse primers - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Food and chemical toxicology : an international journal published for the British Industrial Biological Research Association
Article Title: Effects of a 28-day dietary co-exposure to melamine and cyanuric acid on the levels of serum microRNAs in male and female Fisher 344 rats
doi: 10.1016/j.fct.2016.09.013
Figure Lengend Snippet: Quantification of the levels of selected serum miRNAs using TaqMan miRNA assays in (A) male and (B) female F344 rats (n = 10-12/dose group). Data were normalized to miR-342-3p and are presented as mean fold change ± standard error between MEL&CYA-treated and control groups. Statistically significant differences are indicated by *, p <0.05, **, p <0.01, ***, p <0.001 (Dunnett's test).
Article Snippet: Quantification of serum miRNAs using
Techniques: